Anything and everything cloning: Go...
You are not logged in.
Pages: 1
Dear Steve,
I have some problems with secondary PCR and with no colonies after transformation.
My project id is: https://www.rf-cloning.org/rf_cloning_project.php?proj_id=c4ca73f79abf68ca539ef3fb32432d55
I use Phusion High-Fidelity DNA Polymerase [Agilent Technologies] in 2-step and 3-step PCR method (with annealing temperature of 71°C).
If I obtained colonies after transformation these were only a few (6-8 colonies) and these were very small. I’ve checked them in PCR using primers designed for destination plasmid and also for insert (TAGs_For: GGTCACATCCACAGTTTGAGAAGGG, TAGs_Rev: CCCTTGAAAGTATAGGTTCTCCTTG). Results identified destination plasmid but no presence of insertion. I didn't sequencing plasmid because of potentially lack of insertion.
Thank you in advance for any suggestions.
Best regards,
Anna
Offline
Dawaguru is Pakistan’s leading online medical store that is the best choice for healthcare supplies. We provide the Enfamil A+2 800gm Milk Powder citizens so that they can receive the medicines at their doorstep. We bring a unique effective pharmacy that permits you to order easily. Our range of products includes cough & cold syrups, skin care medicated products, and allergy medicines that can quickly deliver to your doorstep.
Offline
Pages: 1