RF-Cloning.org Forum

AnaHe

Member

Registered: 2023-03-08

Posts: 1

Problems with secondary PCR

Dear Steve,
I have some problems with secondary PCR and with no colonies after transformation.
My project id is: https://www.rf-cloning.org/rf_cloning_project.php?proj_id=c4ca73f79abf68ca539ef3fb32432d55
I use Phusion High-Fidelity DNA Polymerase [Agilent Technologies] in 2-step and 3-step PCR method (with annealing temperature of 71°C).
If I obtained colonies after transformation these were only a few (6-8 colonies) and these were very small. I’ve checked them in PCR using primers designed for destination plasmid and also for insert (TAGs_For: GGTCACATCCACAGTTTGAGAAGGG, TAGs_Rev: CCCTTGAAAGTATAGGTTCTCCTTG). Results identified destination plasmid but no presence of insertion. I didn't sequencing plasmid because of potentially lack of insertion.
Thank you in advance for any suggestions.
Best regards,
Anna

ahmedkhan

Member

Registered: 2023-03-24

Posts: 2

Re: Problems with secondary PCR

Dawaguru is Pakistan’s leading online medical store that is the best choice for healthcare supplies. We provide the Enfamil A+2 800gm Milk Powder citizens so that they can receive the medicines at their doorstep. We bring a unique effective pharmacy that permits you to order easily. Our range of products includes cough & cold syrups, skin care medicated products, and allergy medicines that can quickly deliver to your doorstep.