RF-Cloning.org Forum

Hey Vidhya,
I'm glad to hear that you've made some headway
It's really strange to see this pattern of deletions from your insert sequence. Did you send multiple clones off for sequencing, and all of them came back the same? If that's the case, then the original insert sequence you amplified during the 1° PCR might actually be the culprit. If you're pulling the poly-linker out of another plasmid, I'd suggest sending that off for sequencing.
If, on the other hand, you've already considered this... I'm really not sure what's going on. Secondary structure could certainly interfere with the PCR reaction efficiency, but I wouldn't expect it to cause a predictable pair of deletions.
Is there any other info you can think of that might be relevant?
-Steve

If you are able to recover enough template, I would attempt it both ways. Otherwise, I would probably stick with the two step.
I've got my fingers crossed for you.
-Steve

Hi Tamar,
I've pulled up your project from the backend (AFF-1, right?), and the template portion of the reverse primer is very AT rich. I expect that has something to do with your 1° troubles. Maybe try a touchdown protocol to try and increase your yield. You might need to order new primers though, if yield doesn't improve, with longer template binding regions.
Alternatively, maybe consider switching to handle_url_tag($matches[1], $matches[2]).
-Steve

Great! I love success stories

Hi Hongrulin,
I've found that cleanup is actually detrimental; you generally lose some material in the process.
I use 1 µl of DpnI digested PCR mix in 20 µl of comp cells, so you can safely scale up to 5 µl in your 100 µl of cells.
I'll be very interested to hear from you if this project works out okay. I've never tried anything quite like it before.
Best of luck,
-Steve

I think you should probably still do it, if for no other reason than to further reduce the chance of needing to screen false colonies. Do some back of the napkin calculations to estimate how many ng of parental plasmid you'd end up adding to you transformation after the PCRs are all finished.
With RAM cloning I think it would be more important, given that you're relying on recombination to form the final mature plasmid in vivo. I don't have any actual evidence to back this up, but I'd expect the parental plasmid to have an advantage here, even if it's at a much lower concentration than the linear DNA.

Oh right! RAM cloning was discusses in a previous thread (handle_url_tag($matches[1], $matches[2])), and I had completely forgotten about it.
Skimming through the paper again, it does look like recombination leads to 20-30% weirdness, but it also seems to work where traditional RF may not. Very interesting.
-Steve

Nah, if you just transform bacteria with linear DNA, they chew it up. Wether you use pre-phosphorylated primers or T4 kinase, you will need to include a ligation step before transformation.
As far as using homologous overhangs on the primers, I'm not actually sure what you mean. If you add any extra sequence to the ends of the primers for EMP, it will be amplified along with everything else and you'll still be left with blunt ends.

Ha, well... I think the term 'Spherical Force' may sound a bit more mystical than it really is. Here, I've drawn a picture:

handle_img_tag($matches[2].$matches[4], false, $matches[1])

Does this help?

And yes, the amount of starting material is rather important. This is not your run-of-the-mill PCR reaction.

-Steve

Hi Sand,
You're not alone in misunderstanding how the rf-cloning method leads to a circularized product. Some mental gymnastics are involved.
It all has to do with the positioning of priming sites. Both the 3' and 5' end of a good mega-primer will be bound to it's target parental plasmid, with some non-complementary sequence in the middle. As you know, priming is initiated at the 3' end, and then, because the DNA polymerase does not have 5'-3' exonuclease activity, synthesis stops when the daughter strand bumps into the 5' end of the mega-primer. This happens on the complement strand as well, and two nicks are present when these newly synthesized products anneal — offset by the length of the mega-primer.
In the next round of PCR, if a mega-primer binds to a daughter product, the 3' end it finds itself at the extreme 5' of the template. Meaning there is nothing to synthesize in the 5'-3' direction, and this is why the 2° PCR of an RF-cloning project is non-exponential.
I hope this clarifies, but I can imagine it's still a bit confusing. The best I can do is promise that the logic is sound, and encourage you to draw the process out on paper until you see how the pieces all fit together. You've probably already looked at it, but it might be useful to check out the diagram in the handle_url_tag($matches[1], $matches[2]) again.
Take care,
-Steve

Hmmm... The primers look fine, and the plasmid is reasonably small. For the reactions where you used 600 ng of insert, you're way in the over-kill zone, and might be poisoning the reaction a bit. I would stick to the 50-100ng range for both the plasmid and insert for this project. Maybe give the C2/D2 reaction another try with the reduced primer conc.
Otherwise, one thing I have recommended people do is get an handle_url_tag($matches[1], $matches[2]). You can repurpose the rf-cloning mega-primers for this protocol, no problem, and you have a couple restriction site options well placed in pGSK (BglII or HindIII are probably your best bets). Also, I've sqeezed almost 50 Rxns out of a 10 Rxn kit, so the cost is pretty low to go this route (just cut all recommended volumes 1:5, and use the entire 2 μl final reaction to transform).
Sorry I can't help more. I feel like this project should have worked out okay.
Best of luck,
-Steve

Hey again,
For your 1° PCR, it looks like you used standard primers (A1: GGTTCTGGTCCGGAAGTGCCGCCGACCCC  B1: TTATTCAGCTTCGCGACTCGGCG), which amplified your insert, but did not have any complementarity to the plasmid. If I'm understanding correctly, you then set up the 2° PCR with the purified insert and the hybrid primers (C1/D1 or C2/D2).
Although I imagine this could work, you're confounding the steps that have to occur with the 15-18 cycles of the 2° pcr. You should use the C1/D1 primers to do the exponential 1° PCR, and then use that product as the 'mega-primer' for the 2° PCR.
Have I read you right?
-Steve