RF-Cloning.org Forum

Cate

Member

Registered: 2014-12-10

Posts: 1

Insert is a very small tag - confused about the protocol?

Hello there

I have started an RF project online. I want to insert a his tag into a sequence at a specific site (CATCATCATCATCATCAT). The rf cloning website has given me the following information, with the his tag sequence overlapping. It also says that the insert will be synthesised by the primers due to the actual insert being small, but I don't understand the next step. Can anyone please help me? I am also confused as to how the whole plasmid with the insert will ligate at the ends after extension? Will the plasmid be linearised? Will phosphorylation and ligation be needed? Thank you for your help!

Forward Primer
Plasmid annealing = 54°C     Target annealing = 55°C    Length = 57
ATTTAAAGCTCAAAATAAAAAAGAGTTTTAAAATGCATCATCATCATCATCATGGAA

Reverse Primer
Plasmid annealing = 57°C     Target annealing = 55°C    Length = 56
TTTTCAGTGTTATACAAATAAAAACCAGAATTTCCATGATGATGATGATGATGCAT
The insert is fully synthesized by the primers. Use a 5 cycle PCR reaction (w/o any plasmid) to anneal and extend 5ng of each primer.
   
New Plasmid Size    Insert Sites    Insert Size
88bps    11557bps    3734-3734     18bps

2° PCR conditions
Extension Time    ng of insert    ng of plasmid
3:48 mins    21.1    138.5

Steve Bond

Administrator

Registered: 2014-01-23

Posts: 130

Re: Insert is a very small tag - confused about the protocol?

Hi Cate,
Small inserts are great, because you don't need to do a full 1° PCR and product purification. Set up the 2° PCR and add ~5ng of each hybrid primer (you can almost certainly get away with 'eyeballing' this by diluting your primers to 0.5μM and just adding 1μl of each), but LEAVE OUT the template plasmid. Run a preliminary 5 cycle reaction:

initial
98 °C --> 30 sec

cycle 5x
98 °C --> 5 sec   
55 °C --> 20 sec   
72 °C --> 10 sec 

Pull your samples out of the machine and add the plasmid. Then stick it back in the machine and continue with a normal 15-18 cycle 2° PCR program.

To your other questions, have a look at the diagram at the top of the Q and A. The two halves of the daughter plasmid do not form a blunt-ended linear product when they anneal, but instead form a nicked loop. The nicks are repaired by the bacteria post transformation, so no ligation necessary
Best of luck with your project,
-Steve