Anything and everything cloning: Go...
New accounts disabled to block spam. The forum is just an archive now.
Pages: 1
Hi all,
I would like to start by thanking the community and site creator(s) for the excellent work that you have going on here. Thanks ![]()
Now then, my cloning is not working
Primers I have been using:
1st PCR : A1= GGTTCTGGTCCGGAAGTGCCGCCGACCCC B1= TTATTCAGCTTCGCGACTCGGCG
I tried two different sets of primers for the 2nd PCR and will list them both.
2nd PCR (set 1): C1= GAGCGCATCTGCGAGTAACAGCACCGGTTCTGGTCCGGAAGTGCCGCCGA
D1= CAAGCTTAGATCTGGATCTTGTACATTATTCAGCTTCGCGACTCGGCGGA
(set 2): C2= GCGCATCTGCGAGTAACAGCACCGGTTCTGGTCCGGAAGTGC
D2= GCGTGGTACCAAGCTTAGATCTGGATCTTGTACATTATTCAGCTTCGCGACTCGG
Why the differences? Well, I am using Q5, and I don't know if it works. But by using the NEB calculator, we find some serious differences in recommended temperatures. Thus, I modified the second set for annealing temps near 72C (for either side). Hope that makes sense.
I have tried both 3-step PCR with annealing temps near 62C and a 2-step PCR (18x cycles).
I use 2uL of the final reaction (post DpnI) to chemically transform commercial NEB 5 alpha cells.
Still no luck, and now my supervisor thinks I'm daft
They Love you until something goes wrong...
Offline
Hey there,
I went digging through the backend, and found one project attached to your user account (pGSK-44mer). I think I see what your issue is, but I'd like some more info before I make any suggestions. Can you post the exact protocol you used for both the primary and secondary PCR (detailing the precise content of your reactions)?
Thanks,
-Steve
Offline
OK, here goes...
The amounts used were the same as those recommended in your try this first.
Cycling conditions were 95C (30s) followed by 35x 95C(10s) + 52C(20s) + 72C(20s) completing the reaction with a final extension of 72C(2min). The band was excised and Qiagen'd in 30uL EB. Nanodrop indicated 32.5 ng/uL whereas a Qubit fluorometer indicated 185 ng/uL. *there was only one band on my gel when analyzed. I decided to use the nanodrop numbers given that they were the lower numbers.
Using C1/D1:
The secondary PCR was conducted in a 20uL volume using 50ng template plasmid and 100ng of insert. Cycling was 95C(2min) and 18X cycled {95C(10s) + 72C(2min30s)} followed by a final extension of 72C(5min).
(All) reactions were then incubated in the presence of DpnI as recommended (2 hours at 37C followed by 20min at 80C). I won't mention this again for brevity.
2uL of this reaction was used to transform 50uL of commercially competent cells (no control here). Six colonies did grow, but sequencing indicated that the DpnI reaction did not completely digest the parental template.
I tried the 2nd PCR again using 10ng template and 100ng ultramers (and cycled 20x instead of 18x). No go. And no colonies including false positives.
I tried a third round using 100ng of parental template. This resulted in 5 false positives. (I realize thats too much template).
Another attempt used 20ng template and 150ng megaprimers. The cycling was conducted using 98C (3min) and 15x {98C(30s) + 60C(30s) + 72C(3min30s)} and final extension of 72C(3min). Used 1uL for transformation.
Using C2/D2 product:
Used 50ng template and 600ng (nanodrop) of C2D2 product/ultramer. In this case, after excising the band and Qiaprepping it, I eluted using 50uL of warm water and vacuum dried the sample to 10uL. Cycled using 95C(1min) + 18x{95C(20s) + 70C(2min)} and a final extension of 70C(5min). Used 2.5uL for transformation.
Next, again used 50ng template and 600ng ultramer, but tried three step PCR cycling 95C(3min) and 18x{95C(20s) + 65C(20s) + 72C(2min30s)} + 72C(3min). Again, 2.5uL used to transform.
And so, here we are... baffled.
Also, the second set of primers (C2 and D2) were designed using NEB's calculator. The plasmid side of the ultramers anneal at 72C whereas the insert anneal at 66/67C. The only strange thing I find about NEB's recommendations is to process the reaction +3C from the anneal temps... this makes no sense. I imagine that this site's calculator will give me much lower numbers than NEB's calculator.
I should add that I HAVE used Q5 successfully in a previous experiment... although the thermocycler had 95 temperature ramping errors (so God knows what the temps really were), and only a few colonies appeared.
Offline
Hey again,
For your 1° PCR, it looks like you used standard primers (A1: GGTTCTGGTCCGGAAGTGCCGCCGACCCC B1: TTATTCAGCTTCGCGACTCGGCG), which amplified your insert, but did not have any complementarity to the plasmid. If I'm understanding correctly, you then set up the 2° PCR with the purified insert and the hybrid primers (C1/D1 or C2/D2).
Although I imagine this could work, you're confounding the steps that have to occur with the 15-18 cycles of the 2° pcr. You should use the C1/D1 primers to do the exponential 1° PCR, and then use that product as the 'mega-primer' for the 2° PCR.
Have I read you right?
-Steve
Offline
No, I'm sorry, was trying to be brief and did not mention the PCR reaction following the initial A1/B1 reaction. I shouldn't have included the A1/B1 since I think this is confusing, or actually included the C1/D1 pcr reaction in the above writeup.
The A1/B1 primers were used to amplify a peptide. This was again amplified using the C1 and D1 primers. The C1D1 (or C2D2) product was used during secondary PCR.
Maybe I should have just skipped the initial amplification with A1/B1 and just used C1/D1 ; I just don't know how much new sequence I can introduce using standard PCR and played it safe using the A1/B1.
Sorry about that confusing lack of communication.
Offline
Hmmm... The primers look fine, and the plasmid is reasonably small. For the reactions where you used 600 ng of insert, you're way in the over-kill zone, and might be poisoning the reaction a bit. I would stick to the 50-100ng range for both the plasmid and insert for this project. Maybe give the C2/D2 reaction another try with the reduced primer conc.
Otherwise, one thing I have recommended people do is get an handle_url_tag($matches[1], $matches[2]). You can repurpose the rf-cloning mega-primers for this protocol, no problem, and you have a couple restriction site options well placed in pGSK (BglII or HindIII are probably your best bets). Also, I've sqeezed almost 50 Rxns out of a 10 Rxn kit, so the cost is pretty low to go this route (just cut all recommended volumes 1:5, and use the entire 2 μl final reaction to transform).
Sorry I can't help more. I feel like this project should have worked out okay.
Best of luck,
-Steve
Offline
I was talking with a colleague today that told me the NEB calculator is not very dependable. He suggested using the IDT calculator, which I will use to detect any notable discrepancy. I will also try using a smaller amount of primers. There are sooo many protocols that use variable concentrations/enhancers/cycling conditions. I will keep you guys posted.
And again, note... that I have had success using the Q5 enzyme in some previous work, so you can refer to this thread as a somewhat success with Q5.
No matter what, I am thankful for you support Steve, and appreciate the site. Great work bud.
Offline
Ya, I've used the IDT tools for years. It would be nice to implement some of them directly in the rf-cloning site, but when I naively started to build the thing way back when, I didn't really set things up for easy extensibility... Hopefully I'll get a chance to do a complete re-write from the ground up in the next year or two, make it more open source, and add some new toys ![]()
Offline
Pages: 1