Anything and everything cloning: Go...
You are not logged in.
Dear sir,
I have tried several times with Q5 polymerase to amplify my desired genes from different c-DNA sources with recommended primer conc. (final 500nm) but unfortunately unable to get any band for the PCR products. The PCR conditions that I have used as follows:
forward primer: GCGTTTAAACTTAAGCTTGGTACCGAGATGGACGAACTGTTCCCC
reverse primer: GGTTTAAACGGGCCCTCTAGACTTTAGGAGCTGATCTGACTCAG
annealing temperature: 64 degree (obtained from NEB Tm Calculator)
35 cycles
c-DNA- 1-1.5 ug
Please suggest what to do?
-Subir
Offline
Hi Subir,
I'm sorry to hear that your PCR isn't working. The primary PCR should not be such a big issue, and I recommend trying some of the troubleshooting suggestions from NEB
https://www.neb.com/tools-and-resources … ting-guide
If you still have no success, please post again with the different conditions you have tried.
Best of luck,
-Steve
Offline
Dear Steve,
Thanks for the reply. What are the changes should I try first? One point I found from NEB that for c-DNA templates, 10-100 ng of c-DNA is to be used.. so I am trying first with that modification..
regards-
Subir
Offline
Hi Subir,
Write out the exact protocol you are using (reagent concentrations and cycling conditions). This might help with the troubleshooting.
-Steve
Offline
Dear Steve,
I am trying to amplify Nrf2, RelA, HoxC6 and c-JUN. All possess long introns, therefore I am using c-DNA as template. c-DNAs are prepared from MDA-MB-231 breast cancer cell line and some tumor tissues of breast cancer patients using MMLV RT and random hexamer.
For 50 ul of PCR mix, we are using 100 ng of c-DNA, 0.5 ul of Q5 polymerase, 1ul of dNTP (from 10mM mix). we have tried both the annealing temperature given here and the other obtained from NEB Tm calculator.
PCR details:
Initial Denaturation 98°C 30 seconds
35 Cycles
98°C -10 seconds
Annealing Temp.- 30 seconds
72°C 30 seconds/kb
Final Extension 72°C 2 minutes
Hold 4–10°C
Still getting no band, clear gel without any smearing also. Please suggest what to do now.
Offline
Hi Subir,
Have you included a positive control in your experiment? Perhaps using GAPDH primers?
-Steve
Offline
Dear sir,
Yes, I have checked first with 18s expression, and it was perfect.
Will you please check my primers that I have designed here...
I am really feeling helpless.
-Subir
Last edited by bubunmicro@gmail.com (2015-06-30 19:33:14)
Offline
Try reducing your annealing temperature to 55°C.
You said you are using 65°C, which it to hot for your RelA primer set.
Offline