RF-Cloning.org Forum

Anything and everything cloning: Go...

You are not logged in.

#1 Re: rf-cloning troubles » Problematic to say the least » 2014-12-10 22:32:55

pcr

I was talking with a colleague today that told me the NEB calculator is not very dependable. He suggested using the IDT calculator, which I will use to detect any notable discrepancy. I will also try using a smaller amount of primers. There are sooo many protocols that use variable concentrations/enhancers/cycling conditions. I will keep you guys posted.

And again, note... that I have had success using the Q5 enzyme in some previous work, so you can refer to this thread as a somewhat success with Q5.

No matter what, I am thankful for you support Steve, and appreciate the site. Great work bud.

#2 Re: rf-cloning troubles » Problematic to say the least » 2014-12-10 17:09:05

pcr

No, I'm sorry, was trying to be brief and did not mention the PCR reaction following the initial A1/B1 reaction. I shouldn't have included the A1/B1 since I think this is confusing, or actually included the C1/D1 pcr reaction in the above writeup.

The A1/B1 primers were used to amplify a peptide. This was again amplified using the C1 and D1 primers. The C1D1 (or C2D2) product was used during secondary PCR.

Maybe I should have just skipped the initial amplification with A1/B1 and just used C1/D1 ; I just don't know how much new sequence I can introduce using standard PCR and played it safe using the A1/B1.

Sorry about that confusing lack of communication.

#3 Re: rf-cloning troubles » Problematic to say the least » 2014-12-10 16:08:08

pcr

OK, here goes...

The amounts used were the same as those recommended in your try this first.

Cycling conditions were 95C (30s) followed by 35x 95C(10s) + 52C(20s) + 72C(20s) completing the reaction with a final extension of 72C(2min). The band was excised and Qiagen'd in 30uL EB. Nanodrop indicated 32.5 ng/uL whereas a Qubit fluorometer indicated 185 ng/uL. *there was only one band on my gel when analyzed. I decided to use the nanodrop numbers given that they were the lower numbers.

Using C1/D1:
The secondary PCR was conducted in a 20uL volume using 50ng template plasmid and 100ng of insert. Cycling was 95C(2min) and 18X cycled {95C(10s) + 72C(2min30s)} followed by a final extension of 72C(5min).

(All) reactions were then incubated in the presence of DpnI as recommended (2 hours at 37C followed by 20min at 80C). I won't mention this again for brevity.

2uL of this reaction was used to transform 50uL of commercially competent cells (no control here). Six colonies did grow, but sequencing indicated that the DpnI reaction did not completely digest the parental template.

I tried the 2nd PCR again using 10ng template and 100ng ultramers (and cycled 20x instead of 18x). No go. And no colonies including false positives.

I tried a third round using 100ng of parental template. This resulted in 5 false positives. (I realize thats too much template).

Another attempt used 20ng template and 150ng megaprimers. The cycling was conducted using 98C (3min) and 15x {98C(30s) + 60C(30s) + 72C(3min30s)} and final extension of 72C(3min). Used 1uL for transformation.

Using C2/D2 product:
Used 50ng template and 600ng (nanodrop) of C2D2 product/ultramer. In this case, after excising the band and Qiaprepping it, I eluted using 50uL of warm water and vacuum dried the sample to 10uL. Cycled using 95C(1min) + 18x{95C(20s) + 70C(2min)} and a final extension of 70C(5min). Used 2.5uL for transformation.

Next, again used 50ng template and 600ng ultramer, but tried three step PCR cycling 95C(3min) and 18x{95C(20s) + 65C(20s) + 72C(2min30s)} + 72C(3min). Again, 2.5uL used to transform.

And so, here we are... baffled.

Also, the second set of primers (C2 and D2) were designed using NEB's calculator. The plasmid side of the ultramers anneal at 72C whereas the insert anneal at 66/67C. The only strange thing I find about NEB's recommendations is to process the reaction +3C from the anneal temps... this makes no sense. I imagine that this site's calculator will give me much lower numbers than NEB's calculator.

I should add that I HAVE used Q5 successfully in a previous experiment... although the thermocycler had 95 temperature ramping errors (so God knows what the temps really were), and only a few colonies appeared.

#4 rf-cloning troubles » Problematic to say the least » 2014-12-09 20:31:22

pcr
Replies: 7

Hi all,

I would like to start by thanking the community and site creator(s) for the excellent work that you have going on here. Thanks big_smile

Now then, my cloning is not working hmm  Primers I have been using:

1st PCR : A1= GGTTCTGGTCCGGAAGTGCCGCCGACCCC  B1= TTATTCAGCTTCGCGACTCGGCG

I tried two different sets of primers for the 2nd PCR and will list them both.

2nd PCR (set 1): C1= GAGCGCATCTGCGAGTAACAGCACCGGTTCTGGTCCGGAAGTGCCGCCGA
                         D1= CAAGCTTAGATCTGGATCTTGTACATTATTCAGCTTCGCGACTCGGCGGA

             (set 2): C2= GCGCATCTGCGAGTAACAGCACCGGTTCTGGTCCGGAAGTGC
                         D2= GCGTGGTACCAAGCTTAGATCTGGATCTTGTACATTATTCAGCTTCGCGACTCGG

Why the differences? Well, I am using Q5, and I don't know if it works. But by using the NEB calculator, we find some serious differences in recommended temperatures. Thus, I modified the second set for annealing temps near 72C (for either side). Hope that makes sense.

I have tried both 3-step PCR with annealing temps near 62C  and a 2-step PCR (18x cycles).
I use 2uL of the final reaction (post DpnI) to chemically transform commercial NEB 5 alpha cells.

Still no luck, and now my supervisor thinks I'm daft tongue

They Love you until something goes wrong...

#5 Re: Novel protocols » Q5 anyone? » 2014-12-09 20:22:36

pcr

So... did anything come from this? I should have just bought some phusion but the PI insisted we use the Q5. It doesn't seem to be working, yet I am hesitant to blame the Q5.

In other words... BUMP!

Board footer

Powered by FluxBB