Anything and everything cloning: Go...
New accounts disabled to block spam. The forum is just an archive now.
Pages: 1
Dear sir,
Yes, I have checked first with 18s expression, and it was perfect.
Will you please check my primers that I have designed here...
I am really feeling helpless.
-Subir
Dear Steve,
I am trying to amplify Nrf2, RelA, HoxC6 and c-JUN. All possess long introns, therefore I am using c-DNA as template. c-DNAs are prepared from MDA-MB-231 breast cancer cell line and some tumor tissues of breast cancer patients using MMLV RT and random hexamer.
For 50 ul of PCR mix, we are using 100 ng of c-DNA, 0.5 ul of Q5 polymerase, 1ul of dNTP (from 10mM mix). we have tried both the annealing temperature given here and the other obtained from NEB Tm calculator.
PCR details:
Initial Denaturation 98°C 30 seconds
35 Cycles
98°C -10 seconds
Annealing Temp.- 30 seconds
72°C 30 seconds/kb
Final Extension 72°C 2 minutes
Hold 4–10°C
Still getting no band, clear gel without any smearing also. Please suggest what to do now.
Dear Steve,
Thanks for the reply. What are the changes should I try first? One point I found from NEB that for c-DNA templates, 10-100 ng of c-DNA is to be used.. so I am trying first with that modification..
regards-
Subir
Dear sir,
I have tried several times with Q5 polymerase to amplify my desired genes from different c-DNA sources with recommended primer conc. (final 500nm) but unfortunately unable to get any band for the PCR products. The PCR conditions that I have used as follows:
forward primer: GCGTTTAAACTTAAGCTTGGTACCGAGATGGACGAACTGTTCCCC
reverse primer: GGTTTAAACGGGCCCTCTAGACTTTAGGAGCTGATCTGACTCAG
annealing temperature: 64 degree (obtained from NEB Tm Calculator)
35 cycles
c-DNA- 1-1.5 ug
Please suggest what to do?
-Subir
Pages: 1