RF-Cloning.org Forum

MY insert is 876 bp.I am trying to amplify gene from bacteria genome and insert it to plasmid having 5851 bp.My forward and reverse primers are ACCAACAAGGACCATAGCATATATGTTCACGGGAAGTATTGTCG & GTGATGAGATCGAAGATCTGAACCCAGCAAACCGGCATGCTTA respectively.For primary reaction i am directly picking colony from plate as source for bacterial genome.Primary PCR coditions are
94 for 5 min
98 for 1 min
98 for 30 sec
59 for 1 min
72 for 1 min 30 sec
30 cycles
72 for 5 min.
I am getting almost exact bp as suppose to get in agarose gel.One problem is after pcr purification conc is less around 11 ng.So i did amplyfy again with primers,now my conc is good to proceed for secondary reaction.For second reaction
i using this condtions below
98 for 30 sec
98 for 30 sec
57 for 1 min
72 for 5 min
But in gel it is smeared band.Please help me fixing this.Thank you.