RF-Cloning.org Forum

Hello there

I have started an RF project online. I want to insert a his tag into a sequence at a specific site (CATCATCATCATCATCAT). The rf cloning website has given me the following information, with the his tag sequence overlapping. It also says that the insert will be synthesised by the primers due to the actual insert being small, but I don't understand the next step. Can anyone please help me? I am also confused as to how the whole plasmid with the insert will ligate at the ends after extension? Will the plasmid be linearised? Will phosphorylation and ligation be needed? Thank you for your help!

Forward Primer
Plasmid annealing = 54°C     Target annealing = 55°C    Length = 57
ATTTAAAGCTCAAAATAAAAAAGAGTTTTAAAATGCATCATCATCATCATCATGGAA

Reverse Primer
Plasmid annealing = 57°C     Target annealing = 55°C    Length = 56
TTTTCAGTGTTATACAAATAAAAACCAGAATTTCCATGATGATGATGATGATGCAT
The insert is fully synthesized by the primers. Use a 5 cycle PCR reaction (w/o any plasmid) to anneal and extend 5ng of each primer.
   
New Plasmid Size    Insert Sites    Insert Size
88bps    11557bps    3734-3734     18bps

2° PCR conditions
Extension Time    ng of insert    ng of plasmid
3:48 mins    21.1    138.5